Gene map  Home
Symbol a...p
Symbol q...w
Symbol x...z
Composite map
Physical Map
Other genes




STS marker




cDNA clones of barley (439)




















RFLP, DNA clone p3NTR, function: 3’untranslated region of  Adh1A, copy number:1


pSh2.25; ADP glucose pyrophosphorylase


RFLP, cDNA clone of wheat gene alpha-Amy1 (AMY-46)


RFLP, cDNA clone of wheat gene alpha-Amy2 (AMY 4848)


RFLP, cDNA clone of wheat gene alpha-Amy3 (AMY 33)


Arbitrary primer for rye genome mapping, RAPD (299,355)


RAPD marker, primer GACTACGGGG, 1600 bp fragment (412)


RAPD marker, primer CCGAATTCCC, 1400 bp fragment (412)


RAPD marker, primer ACGCCCAGAC, 520 bp fragment (412)


RAPD marker, primer TGGATCCGC, 550 bp fragment (412)


RAPD marker, primer GCACGTAGAT, 950 bp fragment (412)


RAPD marker, primer ACTCACTACA, 850 bp fragment (412)


RAPD marker, primer ACTCACTACA, 1030 bp fragment (412)


RAPD marker, primer CAGCCTACCT, 500 bp fragment (355,412)


RAPD marker, primer GTAGCCGTCT, 370 bp fragment (355,412)


RAPD marker, primer GTAGCCGTCT, 750 bp fragment (355), ACTCACTACA, 750 bp fragment (,412)


RAPD marker, primer CTGCTGGGAC, 590 bp fragment (412)


RAPD marker, primer AACGAATGCC, 870 bp fragment (412)


RAPD marker, primer CGGCTGACTT, 900 bp fragment (412)


RAPD marker, primer CACAGCGATA, 700 bp fragment (412)


RAPD marker, primer GTGTACGGAT, 1100 bp fragment (412)


RAPD marker, primer CTCACCGTCC, 590 bp fragment (412)


RAPD marker, primer TCTCTGCGCT, 850 bp fragment (412)


RAPD marker, primer TGCCCGTCGT, 900 bp fragment (412)


RAPD marker, primer TCACAGACGC, 740 bp fragment (412)


RAPD marker, primer TCGCCAGAGT, 1000 bp fragment (412)


RAPD marker, primer TGCTCGGTTC, 1100 bp fragment (412)


RAPD marker, primer TGTCCAGCTT, 1200 bp fragment (412)


RAPD marker, primer TCGCCCCATT, 900 bp fragment (412)


RAPD marker, primer AGTTCGTCTG, 1000 bp fragment (412)


RAPD marker, primer GTCCACACGG, 400 bp fragment (412)


RAPD marker, primer CTCACCGTCC, 750 bp fragment (412)


RAPD marker, primer TGCGGCTGAG, 650 bp fragment (412)


RAPD marker, primer GCAACTACGT, 1200 bp fragment (412)


RAPD marker, primer CTCGAGGTAA, 1030 bp fragment (412)


RAPD marker, primer GAGGATCCCT, 570 bp fragment (412)


RAPD marker, primer TCCGACAAGA, 450 bp fragment (412)


RAPD marker, primer CACCATCCAA, 840 bp fragment (412)


RAPD marker, primer CTCACCGTCC, 1100 bp fragment (412)


RAPD marker, primer TGCCCTGCGT, 1200 bp fragment (412)


RAPD marker, primer TCGCCAGAGT, 1550 bp fragment (412)


RAPD marker, primer ACGCGCATGT, 950 bp fragment (412)


RAPD marker, primer TAGCGGCTAG, 480 bp fragment (412)


RAPD marker, primer TCTCTGCGCT, 400 bp fragment (412)


RAPD marker, primer CCGAGTCAAA, 490 bp fragment (412)


RAPD marker, primer GTGTAAGCCG, 1000 bp fragment (412


RAPD marker, primer GCACGTAGAT, 490 bp fragment (412)


RAPD marker, primer GAACTCCGCT, 900 bp fragment (412)


RAPD marker, primer TCGCCAGAGT,490 bp fragment (412)


RAPD marker, primer CGCGCACAAT, 960 bp fragment (412)


RAPD marker, primer GGTCGGAGAA, 650 bp fragment (412)


RAPD marker, primer CCCTACCGAC, 550 bp fragment (412)


RAPD marker, primer AACGCGTTCT, 2000 bp fragment (412)


RAPD marker, primer CGTACGGATA, 2000 bp fragment (412)


RAPD marker, primer ACGGTACCAG, 850 bp fragment (412)


RAPD marker, primer CGTCGGAGAA, 539 bp fragment (412)


RAPD marker, primer ATGGATCCGC, 870 bp fragment (412)


RAPD marker, primer CAAACGTCGC, 700 bp fragment (412)


RAPD marker, primer CACAGCTGCG, 750 bp fragment (355,412)


RAPD marker, primer CACAGCGAAA, 450 bp fragment (355,412)


RAPD marker, primer ACCTCAGCCT, 450 bp fragment (355,412)


RAPD marker, primer GGGAACTGAT, 800 bp fragment (412)


RAPD marker, primer CATCCCCCTG, 1200 bp fragment (412)


RAPD marker, primer CATCCCCCTG, 1150 bp fragment (412)


RAPD marker, primer TTGCGGAGAA, 520 bp fragment (412)


RAPD marker, primer GTTTCGCTGG, 460 bp fragment (412)


RAPD marker, primer AGGAGACTGG, 830 bp fragment (412)


RAPD marker, primer CCGTCGCCTA, 670 bp fragment (412)


RAPD marker, primer AAGCACCGGC, 450 bp fragment (412)


RAPD marker, primer CAGACGGTGT, 880 bp fragment (412)


RAPD marker, primer CCTTGACGCA, 430 bp fragment (412)


RAPD marker, primer CACAGCGAAT, 800 bp fragment (412)


RAPD marker, primer CGTCTGGGAA, 900 bp fragment (412)


RAPD marker, primer CCTTGCAACT, 850 bp fragment (412)


RAPD marker, primer TCAGCCCCTG, 800 bp fragment (412)


RAPD marker, primer GCACGTAGAT, 500 bp fragment (412)


RAPD marker, primer AACGGTGACC, 750 bp fragment (412)


RAPD marker, primer AACGGTGACC, 1600 bp fragment (412)


RAPD marker, primer CCGAATTCCC, 1100 bp fragment (412)


RAPD marker, primer GTGATCGCAG, 530 bp fragment (412)


RAPD marker, primer GGTCTAGAGG, 910 bp fragment (412)


RAPD marker, primer GGTCTAGAGG, 800 bp fragment (412)


RAPD marker, primer ATGACGTTGA, 830 bp fragment (412)


RAPD marker, primer GGACTGGAGT, 900 bp fragment (412)


RAPD marker, primer CACAGCGAAA, 700 bp fragment (355)


RAPD marker, primer CCGAGTCAAA, 650 bp fragment (412)


RAPD marker, primer CGATAGCGGA, 700 bp fragment (412)


RAPD marker, primer TGGCGTCCAG, 450 bp fragment (412)


RAPD marker, primer AACGGTGACC, 820 bp fragment (412)


RAPD marker, primer CACTCTCCTC, 700 bp fragment (412)


RAPD marker, primer GGGTTGCCGA, 800 bp fragment (412)


RAPD marker, primer GGATGCATGT, 1800 bp fragment (412)


RAPD marker, primer ACGCGCATGT, 1200 bp fragment (412)


RAPD marker, primer CTCGGCTGAA, 400 bp fragment (412)


RAPD marker, primer CATGTAGACC, 800 bp fragment (412)


RAPD marker, primer GTGTACGGAT,1800 bp fragment (412)


RAPD marker, primer GTGACGTAGG, 710 bp fragment (412)


RAPD marker, primer AGATGCAGCC, 750 bp fragment (412)


RAPD marker, primer GGGTCCCTTG, 840 bp fragment (412)


RAPD marker, primer AACGCGTTCT, 1700 bp fragment (412)


RAPD marker, primer AGTATCGACC, 750 bp fragment (412)


RAPD marker, primer CCACTGTTAG, 350 bp fragment (412)


RAPD marker, primer AGAGATCTCC, 430 bp fragment (412)


RAPD marker, primer CTTCACCCGA, 350 bp fragment (412)


RAPD marker, primer CTTCACCCGA, 540 bp fragment (412)


RAPD marker, primer AACGCGTTCT, 460 bp fragment (412)


RAPD marker, primer GACTACGGGG, 500 bp fragment (412)


RAPD marker, primer TCTCAGCTGG, 650 bp fragment (412)


RAPD marker, primer GGGCCACGCT, 840 bp fragment (412)


RAPD marker, primer AGAATCGGGG, 520 bp fragment (412)


RAPD marker, primer ACGTAGCGAT, 900 bp fragment (355)


RAPD marker, primer CAGCCTACCG, 950 bp fragment (355)


RAPD marker, primer CGGTCCAGGC, 420 bp fragment (412)


RAPD marker, primer GACTCCCGTT, 850 bp fragment (412)


RAPD marker, primer AGCGCGTAAG, 1900 bp fragment (412)


RAPD marker, primer CCTCTGCCCC, 770 bp fragment (412)


RAPD marker, primer GATTTCTGCT, 700 bp fragment (412)


RAPD marker, primer CACAGCCAGT, 700 bp fragment (412)


RAPD marker, primer CGTCGCGTCA, 1400 bp fragment (412)


RAPD marker, primer CACAGCGACT, 940 bp fragment (412)


RAPD marker, primer CGAATCGCGC, 850 bp fragment (412)


RAPD marker, primer GGTCGGAGAT, 1300 bp fragment (412)


RAPD marker, primer ACGGTACCAG, 540 bp fragment (412)


RAPD marker, primer GGTCCCTGAC, 510 bp fragment (412)


RAPD marker, primer GGTCCCTGAC, 1200 bp fragment (412)


RAPD marker, primer GTCCCGACGA, 290 bp fragment (412)


RAPD marker, primer GTCCCGACGA, 750 bp fragment (412)


RAPD marker, primer TCCGCGGTCT, 750 bp fragment (412)


RAPD marker, primer AGGGTGTACG, 350 bp fragment (412)


RAPD marker, primer GTGATCGCAG, 1200 bp fragment (412)


RAPD marker, primer GTCCCGACGA, 290 bp fragment (412)


RAPD marker, primer AGATGCAGCC, 580 bp fragment (412)


RAPD marker, primer CGTCTAGAGG,  510 bp fragment (412)


RAPD marker, primer ACGATGAGCT, 590 bp fragment (412)


RAPD marker, primer GTGATCGCTG, 460 bp fragment (412)


RAPD marker, primer ACCTCAGCCA, 500 bp fragment (355)


RAPD marker, primer CGTCGCGTCA, 1200 bp fragment (355)


RAPD marker, primer GTCCCGACGA, 290 bp fragment (412)


RAPD marker, primer CGGGATGTTA, 440 bp fragment (412)


RAPD marker, primer CCACACACAA, 440 bp fragment (412)


RAPD marker, primer ATGACGTTGA, 640 bp fragment (412)


RAPD marker, primer CCAGGGTGTT, 840 bp fragment (412)


RAPD marker, primer ACTGGATCGT, 210 bp fragment (412)


RAPD marker, primer ACTGGATCGT, 600 bp fragment (412)


RAPD marker, primer GAACGACGCA, 670 bp fragment (412)


RAPD marker, primer GTGTAAGCCG, 620 bp fragment (412)


RAPD marker, primer CCTTGACGCA, 1400 bp fragment (412)


RAPD marker, primer CTGTAGCCGG, 490 bp fragment (412)


RAPD marker, primer GAACTCCGCT, 410 bp fragment (412)


RAPD marker, primer CAGCACCCAT, 630 bp fragment (412)


RAPD marker, primer CTCGAGGTAA, 390 bp fragment (449)


RAPD marker, primer ACCTCAGCGT, 550 bp fragment (449)


RAPD marker, primer GTAGCCGTCT, 700 bp fragment (449)


RAPD marker, primer AGGAGACTGG, 260 bp fragment (449)


RAPD marker, primer CCGTTCCAAA, 900 bp fragment (449)


RAPD marker, primer AACCCACCCG, 650 bp fragment (449)


RAPD marker, primer GCGCGATAAG, 600 bp fragment (449)


RAPD marker, primer CGTGATAAGG, 670 bp fragment (449)


RAPD marker, primer CCCAAGTCAT, 1300 bp fragment (449)


RAPD marker, primer ATGTGTGTGG, 530 bp fragment (449)


RAPD marker, primer GGAGTGTGTA, 1000 bp fragment (449)


RAPD marker, primer GGAGTGTGTA, 750 bp fragment (449)


RAPD marker, primer CTGTAGCCGG, 750 bp fragment (449)


RAPD marker, primer ACCCCCCACG, 620 bp fragment (449)


RAPD marker, primer CTGAGACGGA, 480 bp fragment (449)


RAPD marker, primer ACCTCCAGCG, 1030 bp fragment (449)


RAPD marker, primer CCGCCTAGTC, 900 bp fragment (449)


RAPD marker, primer CCTCTGCCCA, 650 bp fragment (449)


RAPD marker, primer CGCCCCCAGC, 430 bp fragment (449)


RAPD marker, primer CAAGCGGATC, 950 bp fragment (449)


RAPD marker, primer CAGCCTACAG, 600 bp fragment (449)


RAPD marker, primer GTCCGTTGGG, 650 bp fragment (449)


RAPD marker, primer GACAAAGAGG, 550 bp fragment (449)


RAPD marker, primer AAGCCTCGTC, 1700 bp fragment (449)


RAPD marker, primer CAGTCGCGTG, 1400 bp fragment (449)


RAPD marker, primer TGTCCAGCTT, 710 bp fragment (449)


RAPD marker, primer GCCATAAGCG, 920 bp fragment (449)


RAPD marker, primer ACGAAGCTAA, 500 bp fragment (449)


RAPD marker, primer CCACGCTATA, 600 bp fragment (449)


RAPD marker, primer ACATGTTCGG, 1700 bp fragment (449)


RAPD marker, primer CCTCTCGCAA, 410 bp fragment (449)


RAPD marker, primer CGGCCCACGT, 690 bp fragment (449)


RAPD marker, primer TGCAGTTAGT, 730 bp fragment (449)


RAPD marker, primer GGGTAACGCA, 1100 bp fragment (449)


RAPD marker, primer TGTCCAGCTT, 400 bp fragment (412)


RAPD marker, primer GTCCCGACGA, 350 bp fragment (412)


RAPD marker, primer TGCCGCTAAG, 900 bp fragment (412)


RAPD marker, primer TCGCGCTGTC, 700 bp fragment (412)


RAPD marker, primer GTGTACGGAT, 800 bp fragment (412)


RAPD marker, primer GTGATCGCAG, 330 bp fragment (412)


RAPD marker, primer TGCCCGTCGT, 750 bp fragment (412)


RAPD marker, primer GGATGAGACC, 660 bp fragment (412)


RAPD marker, primer TCCCGAACCG, 830 bp fragment (412)


RAPD marker, primer GGGCCACGCT, 1400 bp fragment (412)


RAPD marker, primer ACGCCCAGGG, 1350 bp fragment (412)


RAPD marker, primer ACGCCCAGGG, 650 bp fragment (412)


RAPD marker, primer CCTCTGCCCA, 1100 bp fragment (412)


RAPD marker, primer TCAGAGCGCC, 900 bp fragment (355,412)


RAPD marker, primer CAGCCTACCT, 850 bp fragment (355,412)


RAPD marker, primer CACAGCGAAT, 1500 bp fragment (355,412)


RAPD marker, primer CCAGGGTGAC, 1300 bp fragment (355,412)


RAPD marker, primer TTAGCCGATC, 960 bp fragment (355,412)


RAPD marker, primer CCTCTCGCAA, 550 bp fragment (355,412)


RAPD marker, primer CAGTCTCGTC, 1500 bp fragment (355,412)


RAPD marker, primer CGTCGCGTCA, 1200 bp fragment (355,412)


RAPD marker, primer GGGCTGACTT, 350 bp fragment (412)


RAPD marker, primer CAGCACCCAT, 660 bp fragment (412)


RAPD marker, primer CACAGCGAAT, 490 bp fragment (412)


RAPD marker, primer CGCATTACGC, 1050 bp fragment (412)


RAPD marker, primer GGTCGGAGAT, 980 bp fragment (412)


RAPD marker, primer CCACACACTA, 500 bp fragment (412)


RAPD marker, primer TAGACGTCGC, 1350 bp fragment (412)


RAPD marker, primer AGCCTGTGTG, 550 bp fragment (412)


RAPD marker, primer TTGGGCTGAC, 350 bp fragment (412)


RAPD marker, primer CCTCTGCCCA, 1100 bp fragment (412)


RAPD marker, primer ACGCCCAGGG, 500 bp fragment (412)


RAPD marker, primer CTCCGTTGGG, 1350 bp fragment (412)


RAPD marker, primer GACACGTCTG, 780 bp fragment (412)


RAPD marker, primer CCTCTGCCCA, 780 bp fragment (412)


RAPD marker, primer CCCTACCGAC, 1500 bp fragment (412)


RAPD marker, primer CTCACCGTCC, 1700 bp fragment (412)


RAPD marker, primer GGTCGGAGAA, 1000 bp fragment (412)


RFLP, cDNA clone pc betac51 of barley


RFLP markers (328,410)


Primer sequence GGT GCA TTT CTG GTG GC (410)




Probe for labelling two chromosomes 1R and ?? (482)




RFLP,cDNA clones of barley and rye (410,439)


RFLP, cDNA clone, by EcoRV


RFLP, cDNA clone, by DraI


RFLP, cDNA clone, by XbaI


RFLP, cDNA clone, by DraI




RFLP, cDNA clone, by EcoRI


RFLP, cDNA clone, by EcoRI


RFLP, cDNA clone, by EcoRV






Primer sequence GCGACTCACGAAAGATTGGT (410)


RFLP, cDNA clone, by EcoRV


SSR marker of barley origin (331,471)


RFLP, pCat2.1c


RFLP, cDNA clones of oat (439)




RFLP, cDNA clone, by EcoRI


RFLP, cDNA clone, by EcoRV


RFLP, cDNA clone, by DraI




RFLP, cDNA clone, by EcoRV


RFLP, cDNA clone, by EcoRV


RFLP, cDNA clone, by EcoRV


cRFLP, DNA clone, by DraI




























RFLP, Clone pLamdac.3, function: carboxy-peptidase-1


RFL, DNA clones

Xcslrgh3 ...

RFLP,  marker (330)


DArT markers (Diversity Arrays Technology, microarray-based method allowing for detection of DNA polymorphism at several thousand loci in a single assay without relying on DNA sequence information) (457)


RFLP, DNA clone p1015, function: early-methionine-labelled polypeptide, copy number:3


AFLP marker, primer EAAAMCGG, 220 bp fragment (355,412)


AFLP marker, primer EAAAMCGG, 48 bp fragment (355,412)


AFLP marker, primer EAACMCTG, 92 bp fragment (355)


AFLP marker, primer EAACMCTG, 113 bp fragment (355,412)


AFLP marker, primer EAACMCTG, 142 bp fragment (355,412)


AFLP marker, primer EAAGMCCG, 178 bp fragment (355,412)


AFLP marker, primer EAAGMCCG, 199 bp fragment (355,412)


AFLP marker, primer EAAGMCCG, 218 bp fragment (355,412)


AFLP marker, primer EAATMCGA, 187 bp fragment (355,412)


AFLP marker, primer EAATMCGA, 229 bp fragment (355,412)


AFLP marker, primer EAATMCGT, 140 bp fragment (355,412)


AFLP marker, primer EAATMCGT, 172 bp fragment (355,412)


AFLP marker, primer EAATMCTG, 170 bp fragment (355,412)


AFLP marker, primer EACAMCGG, 143 bp fragment (355,412)


AFLP marker, primer EACAMCGG, 306 bp fragment (355,412)


AFLP marker, primer EACAMCTG, 198 bp fragment (355,412)


AFLP marker, primer EACCMCGC, 156 bp fragment (355,412)


AFLP marker, primer EACCMCGG, 128 bp fragment (355,412)


AFLP marker, primer EACCMCGG, 134 bp fragment (355,412)


AFLP marker, primer EACCMCGG, 200 bp fragment (355,412)


AFLP marker, primer EACCMCTT, 121 bp fragment (355,412)


AFLP marker, primer EACCMCTT, 177 bp fragment (355,412)


AFLP marker, primer EAGCMCAA, 123 bp fragment (355,412)


AFLP marker, primer EAGCMCAA, 233 bp fragment (355,412)


AFLP marker, primer EAGGMCCG, 159 bp fragment (355,412)


AFLP marker, primer EAGTMCAA, 205 bp fragment (355,412)


AFLP marker, primer EAGTMCCT, 189 bp fragment (355,412)


AFLP marker, primer EAGTMCTT, 131 bp fragment (355,412)


AFLP marker, primer EATGMCGG, 141 bp fragment (355,412)


AFLP marker, primer EATGMCGG, 160 bp fragment (355)


AFLP marker, primer EATGMCGG, 181 bp fragment (355,412)


AFLP marker, primer EATTMCTT, 201 bp fragment (355,412)


AFLP marker, primer EAGGMCAG, 152 bp fragment (355)


AFLP marker, primer EAGGMCAG, 243 bp fragment (355)


AFLP marker, primer EAGGMCAG, 286 bp fragment (355)


AFLP marker, primer EAGGMCAG, 308 bp fragment (355,412)


AFLP marker, primer EAAAMCGG, 101 bp fragment (355)


AFLP marker, primer EAAAMCGG, 107 bp fragment (355)


AFLP marker, primer EAACMCCC, 266 bp fragment (355)


AFLP marker, primer EAAGMCCT, 157 bp fragment (355)


AFLP marker, primer EAATMCTG, 167 bp fragment (355)


AFLP marker, primer EACAMCGG, 215 bp fragment (355)


AFLP marker, primer EACAMCTG, 99 bp fragment (355)


AFLP marker, primer EACCMCGC, 129 bp fragment (355)


AFLP marker, primer EACCMCGC, 196 bp fragment (355)


AFLP marker, primer EACTMCCG, 294 bp fragment (355)


AFLP marker, primer EAGCMCAA, 239 bp fragment (355)


AFLP marker, primer EAGCMCGC, 282 bp fragment (355)


AFLP marker, primer EAGGMCCG, 194 bp fragment (355)


AFLP marker, primer EAGGMCCG, 222 bp fragment (355)


AFLP marker, primer EAGGMCTG, 108 bp fragment (355)


AFLP marker, primer EAGTMCGG, 169 bp fragment (355)


AFLP marker, primer EAGTMCTT, 215 bp fragment (355)


AFLP marker, primer EATGMCGG, 144 bp fragment (355)


AFLP marker, primer EATTMCTT, 152 bp fragment (355)


AFLP marker, primer EACCMCTG, 220 bp fragment (355)


AFLP marker, primer EACCMCTG, 205 bp fragment (355)


AFLP marker, primer EACCMCTG, 209 bp fragment (355)


AFLP marker, primer EACGMCAG, 131 bp fragment (355)


AFLP marker, primer EAGGMCAG, 159 bp fragment (355)


AFLP marker, primer EAGGMCAG, 166 bp fragment (355)


AFLP marker, primer EAGGMCAG, 232 bp fragment (355)


AFLP marker, primer EAGGMCAG, 265 bp fragment (355)


AFLP marker, primer EAGGMCAG, 290 bp fragment (355)


AFLP marker, primer EAAAMCAT, 114 bp fragment (355)


AFLP marker, primer EAAGMCCG, 219 bp fragment (355)


AFLP marker, primer EAATMCTG, 147 bp fragment (355)


AFLP marker, primer EAATMCTG, 164 bp fragment (355)


AFLP marker, primer EAATMCGA, 285 bp fragment (355)


AFLP marker, primer EAATMCTG, 204 bp fragment (355)


AFLP marker, primer EACAMCGG, 152 bp fragment (355)


AFLP marker, primer EACAMCTG, 178 bp fragment (355)


AFLP marker, primer EACCMCGC, 209 bp fragment (355)


AFLP marker, primer EACCMCGG, 90 bp fragment (355)


AFLP marker, primer EACCMCTT, 101 bp fragment (355)


AFLP marker, primer EACGMCCG, 114 bp fragment (355)


AFLP marker, primer EACTMCCG, 159 bp fragment (355)


AFLP marker, primer EAGGMCCG, 135 bp fragment (355)


AFLP marker, primer EAGGMCCG, 175 bp fragment (355)


AFLP marker, primer EAGGMCGG, 131 bp fragment (355)


AFLP marker, primer EAGGMCTG, 93 bp fragment (355)


AFLP marker, primer EAGGMCTG, 169 bp fragment (355)


AFLP marker, primer EAGTMCAA, 171 bp fragment (355)


AFLP marker, primer EAGTMCCT, 179 bp fragment (355)


AFLP marker, primer EAGTMCGC, 110 bp fragment (355)


AFLP marker, primer EATGMCGG, 239 bp fragment (355)


AFLP marker, primer EATTMCTT, 121 bp fragment (355)


AFLP marker, primer EATTMCTT, 173 bp fragment (355)


AFLP marker, primer EATTMCTT, 181 bp fragment (355)


AFLP marker, primer EACCMCTG, 112 bp fragment (355)


AFLP marker, primer EACGMCAC, 121 bp fragment (355)


AFLP marker, primer EACGMCAC, 200 bp fragment (355)


AFLP marker, primer EAGGMCAG, 182 bp fragment (355)


AFLP marker, primer EAGGMCAG, 302 bp fragment (355)


AFLP marker, primer EAACMCCC, 178 bp fragment (355)


AFLP marker, primer EAACMCCC, 272 bp fragment (355)


AFLP marker, primer EAACMCTG, 289 bp fragment (355)


AFLP marker, primer EAAGMCCT, 156 bp fragment (355)


AFLP marker, primer EAAGMCCT, 171 bp fragment (355)


AFLP marker, primer EAATMCGA, 268 bp fragment (355)


AFLP marker, primer EAATMCGT, 212 bp fragment (355)


AFLP marker, primer EAATMCGT, 213 bp fragment (355)


AFLP marker, primer EAATMCTG, 196 bp fragment (355)


AFLP marker, primer EACAMCGG, 168 bp fragment (355)


AFLP marker, primer EACAMCTG, 180 bp fragment (355)


AFLP marker, primer EACCMCGC, 267 bp fragment (355)


AFLP marker, primer EACCMCGG, 110 bp fragment (355)


AFLP marker, primer EACCMCTT, 179 bp fragment (355)


AFLP marker, primer EACGMCCG, 131 bp fragment (355)


AFLP marker, primer EACGMCCG, 208 bp fragment (355)


AFLP marker, primer EAGCMCAA, 186 bp fragment (355)


AFLP marker, primer EAGCMCAA, 213 bp fragment (355)


AFLP marker, primer EAGGMCCG, 132 bp fragment (355)


AFLP marker, primer EAGGMCTG, 274 bp fragment (355)


AFLP marker, primer EAGTMCAA, 97 bp fragment (355)


AFLP marker, primer EAGTMCAA, 127 bp fragment (355)


AFLP marker, primer EAGTMCAA, 165 bp fragment (355)


AFLP marker, primer EAGTMCCT, 84 bp fragment (355)


AFLP marker, primer EAGTMCCT, 130 bp fragment (355)


AFLP marker, primer EAGTMCGT, 114 bp fragment (355)


AFLP marker, primer EAGTMCTC, 196 bp fragment (355)


AFLP marker, primer EATGMCGG, 138 bp fragment (355)


AFLP marker, primer EATGMCGG, 270 bp fragment (355)


AFLP marker, primer EACCMCTA, 122 bp fragment (355)


AFLP marker, primer EACGMCAG, 205 bp fragment (355)


AFLP marker, primer EAAAMCAA, 94 bp fragment (355)


AFLP marker, primer EAAAMCAA, 107 bp fragment (355)


AFLP marker, primer EAAAMCAA, 143 bp fragment (355)


AFLP marker, primer EAAAMCAT, 134 bp fragment (355)


AFLP marker, primer EAACMCCC, 184 bp fragment (355)


AFLP marker, primer EAACMCTG, 149 bp fragment (355)


AFLP marker, primer EAAGMCCT, 250 bp fragment (355)


AFLP marker, primer EAATMCGA, 220 bp fragment (355)


AFLP marker, primer EAATMCTG, 87 bp fragment (355)


AFLP marker, primer EAATMCTG, 198 bp fragment (355)


AFLP marker, primer EACCMCGC, 239 bp fragment (355)


AFLP marker, primer EACCMCGG, 172 bp fragment (355)


AFLP marker, primer EAGCMCGC, 205 bp fragment (355)


AFLP marker, primer EAGGMCCG, 141 bp fragment (355)


AFLP marker, primer EAGTMCAA, 179 bp fragment (355)


AFLP marker, primer EAGTMCGG, 283 bp fragment (355)


AFLP marker, primer EAGTMCGG, 285 bp fragment (355)


AFLP marker, primer EACCMCTA, 136 bp fragment (355)


AFLP marker, primer EACGMCAC, 119 bp fragment (355)


AFLP marker, primer EAATMCGT, 121 bp fragment (355)


AFLP marker, primer EAATMCTG, 102 bp fragment (355)


AFLP marker, primer EACAMCTG, 112 bp fragment (355)


AFLP marker, primer EACGMCCG, 203 bp fragment (355)


AFLP marker, primer EACCMCTA, 103 bp fragment (355)


AFLP marker, primer EACCMCTA, 191 bp fragment (355)


AFLP marker, primer EACGMCAG, 100 bp fragment (355)


AFLP marker, primer EACGMCAG, 108 bp fragment (355)


AFLP marker, primer EAGGMCAG, 133 bp fragment (355)


AFLP marker, primer EAGGMCAG, 238 bp fragment (355)


AFLP marker, primer EAGGMCAG, 260 bp fragment (355)


AFLP marker, primer EAGGMCAG, 315 bp fragment (355)


 AFLP marker, primer EAAAMCGG, 175 bp fragment (355)


AFLP marker, primer EAACMCCC, 224 bp fragment (355)


AFLP marker, primer EAACMCTG, 195 bp fragment (355)


AFLP marker, primer EAAGMCCG, 254 bp fragment (355)


AFLP marker, primer EAAGMCCT, 130 bp fragment (355)


AFLP marker, primer EAAGMCCT, 249 bp fragment (355)


AFLP marker, primer EAATMCGT, 208 bp fragment (355)


AFLP marker, primer EACCMCGC, 298 bp fragment (355)


 AFLP marker, primer EAGCMCAA, 108 bp fragment (355)


AFLP marker, primer EAGCMCAA, 222 bp fragment (355)


AFLP marker, primer EAGGMCCG, 158 bp fragment (355)


AFLP marker, primer EAGGMCTG, 164 bp fragment (355)


AFLP marker, primer EAGTMCCT, 94 bp fragment (355)


AFLP marker, primer EAGTMCCT, 95 bp fragment (355)


AFLP marker, primer EAGTMCGG, 147 bp fragment (355)


AFLP marker, primer EAGTMCGT, 81 bp fragment (355)


AFLP marker, primer EAGTMCGT, 94 bp fragment (355)


AFLP marker, primer EAGTMCTC, 151 bp fragment (355)


AFLP marker, primer EAGTMCTC, 191 bp fragment (355)


AFLP marker, primer EAGTMCTT, 171 bp fragment (355)


AFLP marker, primer EACCMCTA, 131 bp fragment (355)


AFLP marker, primer EAGGMCAG, 114 bp fragment (355)


AFLP marker, primer EAGGMCAG, 202 bp fragment (355)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


AFLP marker (296)


RFLP, cDNA clone pGC19, function: bZIP protein


RFLP, PSR39 clone; wheat chloroplast fructose-1.6-biphosphatase

Xfed  ...

Ferredoxin (terminal receptor of  electrons from photo-system I)


RFLP, Germin cDNA


RFLP, pLW2.1








RFLP, DNA clone pTag544, function: low-molecular-weight glutenin, Copy number:1


STS marker (331)
























Microsatellite on 7RS; allele size 117 bp (410)




































































































RFLP marker (330)


RFLP marker (403)


gDNA clones of rye, STS marker




 RFLP marker (330)




A primer (OPR19) amplified 1.35 kb fragment


A primer (OPR07) amplified 1.2 kb fragment


(AC)8(GA)T  670 bp (412)


(TC)8(CT)G  1150 bp (412)


(TC)8(CT)T 700 bp (412)


(CT)8T  700 bp (412)


(CT)8G 950 bp (412)


(AG)8T 500 bp (412)


(AC)8(GA)G 710 bp (412)


(GA)9A 890 bp (449)


(GA)9T 400 bp (449)


(AC)8T 610 bp (449)


(TC)8(Y)G  630 bp (449)


(AG)8T 890 bp (412)


(TC)8(CT)G 640 bp (412)


(CT)8G 1200 bp (412)


(TC)8(GA)T 500 bp (412)


(CT)8A 450 bp (412)


RFLP, Wheat gDNA clones (439)
































RFLP, DNA clone PNVRI, function: lectin, copy number:4


SSR anchor marker (298)


SSR anchor marker (298)


SSR anchor marker (298)


SSR anchor marker (298)


SSR anchor marker (298)


SSR anchor marker (298)


SSR anchor marker (298)


DNA function probe from DNA (cytosine-5)-methyltransferase gene


RFLP marker (330,439)














































RFLP, DNA clone pScR4.T1, rye ribosomal spacer DNA


RFLP, bNRp10


Chromosomal marker for chromosome arm 2RL and/or translocation (447)


RAPD marker designated according to operon technology primer designation


Specific RAPD rye DNA fragments


Specific RAPD rye DNA fragments


Specific RAPD rye DNA fragments


Specific RAPD rye DNA fragments, 1614 bp (337)


Specific RAPD rye DNA fragments


Specific RAPD rye DNA fragments


Specific RAPD rye DNA fragments


Specific RAPD rye DNA fragments


Specific RAPD rye DNA fragments (296)


Specific RAPD rye DNA fragments


Specific RAPD rye DNA fragments


Specific RAPD rye DNA fragments


Specific RAPD rye DNA fragments, 540 bp (337)


Specific RAPD rye DNA fragments


Specific RAPD rye DNA fragments


Specific RAPD rye DNA fragments


Specific RAPD rye DNA fragments


Specific RAPD rye DNA fragments, 795 bp (337)


Specific RAPD rye DNA fragments (296)


Specific RAPD rye DNA fragments, 600 bp (337)


Specific RAPD rye DNA fragments, 330 bp (337)


Specific RAPD rye DNA fragments


Specific RAPD rye DNA fragments


Specific RAPD rye DNA fragments


Specific RAPD rye DNA fragments


Specific RAPD rye DNA fragments


Specific RAPD rye DNA fragments, 1900 bp (337)


Specific RAPD rye DNA fragments


Specific RAPD rye DNA fragments, 990 bp (337)


Specific RAPD rye DNA fragments


Specific RAPD rye DNA fragments, 930 bp (337)


Specific RAPD rye DNA fragments, 450 bp (337)


Specific RAPD rye DNA fragments, 1490 bp (337)


Specific RAPD rye DNA fragments, 440 bp (337)


Specific RAPD rye DNA fragments, 1700 bp (337)


Specific RAPD rye DNA fragments (296)


Specific RAPD rye DNA fragments, 490 bp (337)


 Specific RAPD rye DNA fragments, 1300 bp (337)


Specific RAPD rye DNA fragments (296)


Specific RAPD rye DNA fragments (296)


Specific RAPD rye DNA fragments (296)


Specific RAPD rye DNA fragments, 1010 bp (337)


Specific RAPD rye DNA fragments (296)


Specific RAPD rye DNA fragments, 1730 bp (337)


Specific RAPD rye DNA fragments (296)


Specific RAPD rye DNA fragments (296)


Specific RAPD rye DNA fragments, 650 bp (337)


Specific RAPD rye DNA fragments, 1205 bp (337)


Specific RAPD rye DNA fragments, 1280 bp (337)


Specific RAPD rye DNA fragments


Specific RAPD rye DNA fragments, 485 bp (337)


Specific RAPD rye DNA fragments, 1550 bp (337)


Specific RAPD rye DNA fragments, 1400 bp (337)


Specific RAPD rye DNA fragments, 910 bp (337)


Specific RAPD rye DNA fragments, 1060 bp (337)


Specific RAPD rye DNA fragments (296)


Specific RAPD rye DNA fragments (296)


Specific RAPD rye DNA fragments (296)


Specific RAPD rye DNA fragments (296)


Specific RAPD rye DNA fragments, 1410 bp (337)


ISBP marker (470)




















Pepco; sorghum phosphoeniolpyruvate carboxylase




RFLP, DNA clone P7, function: chloroplast phosphoglyceratekinase, copy number:1


RFLP marker (330)


RFLP, DNA clone PPDK4, function: pyruvate orthophosphate dikinase


RFLP, gDNA clones of barley


RFLP, gDNA and cDNA clones of wheat, STS marker        








a 887 bp genome specific DNA sequence that detects Secale africanum and other rye chromatin incorporated into wheat (427,445)


Purothioninin sequence of 693 bp with a  specific primer set PIR5: ACTGCTACAACCTTTGCCGT








SSR marker (308)










Mikrosatellite, on chromosome 5R, rye donor BE494952, Repeat type and length (CGG) 5, size (bp) 247, alleles 2 (308)


Mikrosatellite, on chromosome 5R, BE495233, Repeat type and length (GAGT) 5, size (bp) 302, alleles 4 (308)


Mikrosatellite, on chromosome 5R, BE495963, Repeat type and length (CAC) 5, size (bp) 221, alleles 3 (308)




Mikrosatellite, on chromosome 5R, rye donor BE586813, Repeat type and length (ACAT) 6, size (bp) 281, alleles 3 (308)


Mikrosatellite, on chromosome 5R,  rye donor BE587316, Repeat type and length (AG) 8, size (bp) 230, alleles 3 (308,439)






Mikrosatellite, on chromosome 5R, rye donor BE637153, Repeat type and length (TAGC) 5, size (bp) 288, alleles 4 (308)






Mikrosatellite, on chromosome 5R, rye donor BE705252, Repeat type and length (CGTC) 5, size (bp) 282, alleles 2 (308)


Mikrosatellite, on chromosome 5R, rye donor BE705296, Repeat type and length (GA) 8, size (bp) 202, alleles 3 (308)




Mikrosatellite, on chromosome 7R, rye donor BE493989, Repeat type and length (GA) 6, size (bp) 172, alleles 4 (308,439)








Mikrosatellite, on chromosome 7R, rye donor BE494705, Repeat type and length (GCC) 5, size (bp) 200, alleles 3 (308)








Mikrosatellite, on chromosome 7RS, rye donor BE496005, Repeat type and length (CAA) 5, size (bp) 215, alleles 2 308,359,439)


Mikrosatellite, on chromosome 7R, rye donor BE496047, Repeat type and length (TC) 7, size (bp) 187, alleles 3 (308)




Mikrosatellite, on chromosome 7R, rye donor BE586481, Repeat type and length (CGC) 5, size (bp) 192, alleles 2 (308,439)










Mikrosatellite, on chromosome 7R, rye donor BE637039, Repeat type and length (AGC) 6, size (bp) 256, alleles 2 (308,439)


Mikrosatellite, on chromosome 7R, rye donor BE637059, Repeat type and length (GGC) 5, size (bp) 226, alleles 2 (308)


Mikrosatellite, on chromosome 7R, rye donor BE637143, Repeat type and length (CGG)5, size (bp) 173, alleles 2 (308)


























AFLP, DNA function probe from DNA replication regulating gene


RFLP marker (330)


SSR marker (331)


Microsatellite on 7R; allele size 213 or 215 bp (410)


Microsatellite on 7RL; allele size 166 or 172 bp (410)


Microsatellite on 7R; allele size 210 bp (410)


Microsatellite on 7RS; allele size 196 bp (410)


Microsatellite on 7R; allele size 153 bp (410)


Microsatellite on 7RL allele size 267, 269 or 278 bp (410)


Microsatellite on 7RL allele size 236 bp (410)


Microsatellite on 7R allele size 155 bp (410)


Microsatellite on 7RL allele size 263 bp (410)


RFLP, rice cDNA clones


STS marker (331,472)


SSAP marker (332)


RFLP, clone pSBP, function:sedoheptulose 1,7 bisphosphate




intermicrosatellite marker (409)


RFLP, gDNA clones of rye


RFLP, gDNA clones of rye


IH69 clone


Mikrosatellite, S. cereale inter-microsatellites (325, 409)


SSR marker (326)


Specific RAPD rye DNA fragments, SSR marker (296,331,409,439)


SSR anchor marker (298); thioredoxin-like protein (439,469,480)


SSR anchor marker (298,325,327,439)




SSR anchor marker (298); farnesylated protein (ATFP6), 439


Microsatellite on 7R; allele size 186 or 188 bp (410,439)






Microsatellite on 7R; allele size 159 bp (410,439)


SSR anchor marker (298,439)


SSR anchor marker (298,439); putative MYB family transcription factor




SSR anchor marker (298,439); ribonucleotide reductase R2






Microsatellite on 7R; allele size 117 bp (410,439)


SSR anchor marker (298,439); hypothetical protein


SSR anchor marker (298,359,439); isomerase-like protein; microsatellite on 7R; allele size 309 or 329 bp (410)






SSR anchor marker (298, 412,439); probable DNA-binding protein GBP16




SSR anchor marker (298,439); acyl-CoA-binding protein


SSR anchor marker (298,439); cysteine proteinase inhibitor




Microsatellite on 7R; allele size 125 or 133 bp (410,439)


SSR anchor marker (298,439)


SSR anchor marker (298,439); myo-inositol 1-phosphate synthase; microsatellite on 7R; allele size 159 bp (410)


SSR anchor marker (298,439); putative UDP-glucose dehydrogenase


SSR anchor marker (298,439); apospory-associated protein C-like


SSR anchor marker (298,439); proline-rich protein


SSR anchor marker (298,439); putative cellulase




SSR anchor marker (298,439); cold-responsive protein COR14a






















SCAR marker (sequence-characterized amplified region) (412)






STS marker (403)


STS marker (403)


SSAP marker (332)


RFLP, DNA clone:pTag1436, function: (gliadin, copy number:3; primer F: CTATTAGTTCGAAAAGCTTATGA R: GCATATGACTCAAATTATTTTTT (460, 461)

Xsec3 (Xglu)

RFLP, DNA clone:pTag1290, function:high-molecular-weight glutenin, copy number:2


RFLP, psT8


SSAP marker (332)


RFLP, genomic DNA clone, by BamHI


RFLP, cDNA clone, by HindIII


RFLP, genomic DNA clone, by HindIII


RFLP, cDNA clone, by HindIII


RFLP, cDNA clone, by HindIII


STS markers (326)




SSR marker (452)




























RFLP, DNA clone (412)


RFLP, DNA function probe from pollen allergen encoding gene


STS marker, (AC)8(GA)T, 670 bp fragment (412)


RFLP, gDNA clones of rye




















= locus Xcwem6c; primer: F: CACGACGTTGTAAAACGAC CCTGCTCTGCCATTACTTGG  R: TGCACCTCCATCTCCTTCTT; in rice, it is described as a drought induced 19 protein (Di19) which can be helpful in studying drought (447)


RFLP, gDNA clones of wheat, by EcoR1  (439)








DNA sequence for endosperm beta-amylase-R1 from NCBI nucleotidedatabase for S. cereale (386, 392)


DNA sequence for endosperm beta-amylase-R1 from NCBI nucleotidedatabase for S. cereale (386, 392)


Yellow necrotic spots on leaves (303)


Resistance to yellow rust (stripe rust) (Puccinia striiformis), genes on chromosomes 1RS and 6RL (509) and 5RL (527)


Yellow stripe

Z  >>> S

Self-incompatility (353)




It indicates a region (band57) along a chromosome according  to the karyogram attached


It  indicates a region between two bands57 (1RS1.1 and 1RS2.1) according to the karyogram attached

   Copyright  R. Schlegel   &   V. Korzun    2004  2005  2006  2007  2008  2009  2010  2011 2012 2013 2014 2015  2016  2017 2018 2019 2020 2021